Review



foxd3  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    R&D Systems foxd3
    (A, B) EBs were generated at day 0 after either d4 (A) or d10 (B) NMP formation and then treated with RA for 10 days (control). In the experimental samples, BMPs were added at day 1 (BMP4+1), day 2 (BMP4+2) or day 4 (BMP4+4) after EB formation, until day 10. Samples were further differentiated for 6 days and then processed for immunohistochemistry (IHC). (C) EBs were labeled with antibodies against LHX2 (dI1, green), <t>FOXD3</t> (dI2, white), ISL1 (dI3, red) and DAPI (all nuclei, blue). (D, E) Quantification of EBs formed from either d4 (D) or d10 (E) NMPs, suggests that dI1s form robustly from the BMP4+1 condition for both d4 and d10 NMPs. In contrast, dI3s form most robustly from BMP4+4 condition for d4 NMPs and the BMP4+1 condition for d10 NMPs. Probability of similarity between control and experimental groups: * p<0.05, ** p<0.005, *** p<0.0005; two-way ANOVA.
    Foxd3, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 71 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxd3/Human+Islet-1+Antibody/bio_rxiv__64898__2025__12__22__696129-323-10-22
    Average 95 stars, based on 71 article reviews
    foxd3 - by Bioz Stars, 2026-08
    95/100 stars

    Images

    1) Product Images from "In vivo human embryonic spinal cord atlas validates stem cell–derived human dorsal interneurons and reveals ASD spinal signatures"

    Article Title: In vivo human embryonic spinal cord atlas validates stem cell–derived human dorsal interneurons and reveals ASD spinal signatures

    Journal: bioRxiv

    doi: 10.64898/2025.12.22.696129

    (A, B) EBs were generated at day 0 after either d4 (A) or d10 (B) NMP formation and then treated with RA for 10 days (control). In the experimental samples, BMPs were added at day 1 (BMP4+1), day 2 (BMP4+2) or day 4 (BMP4+4) after EB formation, until day 10. Samples were further differentiated for 6 days and then processed for immunohistochemistry (IHC). (C) EBs were labeled with antibodies against LHX2 (dI1, green), FOXD3 (dI2, white), ISL1 (dI3, red) and DAPI (all nuclei, blue). (D, E) Quantification of EBs formed from either d4 (D) or d10 (E) NMPs, suggests that dI1s form robustly from the BMP4+1 condition for both d4 and d10 NMPs. In contrast, dI3s form most robustly from BMP4+4 condition for d4 NMPs and the BMP4+1 condition for d10 NMPs. Probability of similarity between control and experimental groups: * p<0.05, ** p<0.005, *** p<0.0005; two-way ANOVA.
    Figure Legend Snippet: (A, B) EBs were generated at day 0 after either d4 (A) or d10 (B) NMP formation and then treated with RA for 10 days (control). In the experimental samples, BMPs were added at day 1 (BMP4+1), day 2 (BMP4+2) or day 4 (BMP4+4) after EB formation, until day 10. Samples were further differentiated for 6 days and then processed for immunohistochemistry (IHC). (C) EBs were labeled with antibodies against LHX2 (dI1, green), FOXD3 (dI2, white), ISL1 (dI3, red) and DAPI (all nuclei, blue). (D, E) Quantification of EBs formed from either d4 (D) or d10 (E) NMPs, suggests that dI1s form robustly from the BMP4+1 condition for both d4 and d10 NMPs. In contrast, dI3s form most robustly from BMP4+4 condition for d4 NMPs and the BMP4+1 condition for d10 NMPs. Probability of similarity between control and experimental groups: * p<0.05, ** p<0.005, *** p<0.0005; two-way ANOVA.

    Techniques Used: Generated, Control, Immunohistochemistry, Labeling



    Similar Products

    94
    Thermo Fisher gene exp foxd3 mm02384867 s1
    (A) Single nuclei were isolated from cortices after dMCAO on days 3 ( n = 3), 7 ( n = 4), 14 ( n = 3), and 28 ( n = 4) and compared with sham controls ( n = 3). (B)–(H) derive from these datasets. (B) Unsupervised clustering of 107,020 nuclei identified 14 clusters. PC, progenitor cell. (C) Early NC signature scoring (Wnt1-associated) highlighted a high-scoring subpopulation within C11. (D) NC regulatory genes (Tfap2b, Foxd1, Sned1, and Eya2) were enriched in C11. (E) DEG analysis of C11 visualized by UMAP and force-directed layout/embedding (FLE) identified NC-related subsets. (F) GO analysis revealed SC2, SC3, and SC5 subclusters as enriched for NCC migration, development, and differentiation. (G) Subclusters refined into seven subsets: SC2 (subsets 1, 2, 4, and 6), SC3 (subsets 0 and 3), and SC5 (subset 5). (H) Upregulated genes in each cluster were consistent with NC lineage programs. (I) GSEA showed subset 1 enriched for stromal signatures and subsets 0 and 3 enriched for radial glia-like signatures. (J) Venn diagram comparing pericyte cluster C13 and subsets 2, 4, and 6. (K–P) Immunohistochemical validation of cluster- and subset-specific markers (low-power anatomical context in ). (K) Klf5 + (subsets 1 and 5) and Bmp7 + (subsets 0 and 3) cells co-localized with <t>Foxd3.</t> (L) CD271 + cells were present in layers I–IV ipsilateral to dMCAO; a subset co-expressed Bmp7. (M) Klf5 + cells co-localized with CD271 in cortical layer II/III. (N) Subset 4: PDGFRβ + /Col3a1 + cells; subset 6: Col3a1 + /PDGFRβ − cells. (O) Subset 2: Ebf2 + /Cped1 + cells adjacent to CD31 + vessels. (P) No co-expression of PDGFRβ and Cped1 (specificity control). DAPI labels nuclei. (Q) Integration of snRNA-seq with spatial transcriptomics showed subsets 2 and 5 enriched ipsilaterally on day 3 post dMCAO and SC3 subsets localized to leptomeninges on days 3 and 14. (R) Representative genes of refined SC2/SC3/SC5 plotted on UMAP. (S–U) CD271 + meningeal cells isolated 3 days post tMCAO (S), expanded in vitro (T), and confirmed to express CD271 and Foxd3 (U). (V) C11 subdivided into SC2, SC3, and SC5, each further resolved into seven subsets based on upregulated DEGs, with NC-lineage enrichment. PC, pericyte; SMC, smooth muscle cell; MG, microglia; FB, vascular fibroblast-like cell; OL, oligodendrocyte; EC, endothelial cell; AC, astrocyte; v, venous; capil, capillary; a, arterial; aa, arteriolar; 1/2/3, subtypes.
    Gene Exp Foxd3 Mm02384867 S1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxd3/Gene+Exp%2E+Foxd3%2C+Mm02384867_s1/pmc12869227-336-11-13
    Average 94 stars, based on 1 article reviews
    gene exp foxd3 mm02384867 s1 - by Bioz Stars, 2026-08
    94/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc anti src
    (A) Single nuclei were isolated from cortices after dMCAO on days 3 ( n = 3), 7 ( n = 4), 14 ( n = 3), and 28 ( n = 4) and compared with sham controls ( n = 3). (B)–(H) derive from these datasets. (B) Unsupervised clustering of 107,020 nuclei identified 14 clusters. PC, progenitor cell. (C) Early NC signature scoring (Wnt1-associated) highlighted a high-scoring subpopulation within C11. (D) NC regulatory genes (Tfap2b, Foxd1, Sned1, and Eya2) were enriched in C11. (E) DEG analysis of C11 visualized by UMAP and force-directed layout/embedding (FLE) identified NC-related subsets. (F) GO analysis revealed SC2, SC3, and SC5 subclusters as enriched for NCC migration, development, and differentiation. (G) Subclusters refined into seven subsets: SC2 (subsets 1, 2, 4, and 6), SC3 (subsets 0 and 3), and SC5 (subset 5). (H) Upregulated genes in each cluster were consistent with NC lineage programs. (I) GSEA showed subset 1 enriched for stromal signatures and subsets 0 and 3 enriched for radial glia-like signatures. (J) Venn diagram comparing pericyte cluster C13 and subsets 2, 4, and 6. (K–P) Immunohistochemical validation of cluster- and subset-specific markers (low-power anatomical context in ). (K) Klf5 + (subsets 1 and 5) and Bmp7 + (subsets 0 and 3) cells co-localized with <t>Foxd3.</t> (L) CD271 + cells were present in layers I–IV ipsilateral to dMCAO; a subset co-expressed Bmp7. (M) Klf5 + cells co-localized with CD271 in cortical layer II/III. (N) Subset 4: PDGFRβ + /Col3a1 + cells; subset 6: Col3a1 + /PDGFRβ − cells. (O) Subset 2: Ebf2 + /Cped1 + cells adjacent to CD31 + vessels. (P) No co-expression of PDGFRβ and Cped1 (specificity control). DAPI labels nuclei. (Q) Integration of snRNA-seq with spatial transcriptomics showed subsets 2 and 5 enriched ipsilaterally on day 3 post dMCAO and SC3 subsets localized to leptomeninges on days 3 and 14. (R) Representative genes of refined SC2/SC3/SC5 plotted on UMAP. (S–U) CD271 + meningeal cells isolated 3 days post tMCAO (S), expanded in vitro (T), and confirmed to express CD271 and Foxd3 (U). (V) C11 subdivided into SC2, SC3, and SC5, each further resolved into seven subsets based on upregulated DEGs, with NC-lineage enrichment. PC, pericyte; SMC, smooth muscle cell; MG, microglia; FB, vascular fibroblast-like cell; OL, oligodendrocyte; EC, endothelial cell; AC, astrocyte; v, venous; capil, capillary; a, arterial; aa, arteriolar; 1/2/3, subtypes.
    Anti Src, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxd3/FoxD3+Rabbit+mAb/pm41499010-148-1-7
    Average 96 stars, based on 1 article reviews
    anti src - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    95
    R&D Systems foxd3
    (A, B) EBs were generated at day 0 after either d4 (A) or d10 (B) NMP formation and then treated with RA for 10 days (control). In the experimental samples, BMPs were added at day 1 (BMP4+1), day 2 (BMP4+2) or day 4 (BMP4+4) after EB formation, until day 10. Samples were further differentiated for 6 days and then processed for immunohistochemistry (IHC). (C) EBs were labeled with antibodies against LHX2 (dI1, green), <t>FOXD3</t> (dI2, white), ISL1 (dI3, red) and DAPI (all nuclei, blue). (D, E) Quantification of EBs formed from either d4 (D) or d10 (E) NMPs, suggests that dI1s form robustly from the BMP4+1 condition for both d4 and d10 NMPs. In contrast, dI3s form most robustly from BMP4+4 condition for d4 NMPs and the BMP4+1 condition for d10 NMPs. Probability of similarity between control and experimental groups: * p<0.05, ** p<0.005, *** p<0.0005; two-way ANOVA.
    Foxd3, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxd3/Human+Islet-1+Antibody/bio_rxiv__64898__2025__12__22__696129-323-10-22
    Average 95 stars, based on 1 article reviews
    foxd3 - by Bioz Stars, 2026-08
    95/100 stars
      Buy from Supplier

    93
    Addgene inc morpholino foxd3 mo aug 5 cactggtgcctccagacagggtcat 3 gene tools
    (A, B) EBs were generated at day 0 after either d4 (A) or d10 (B) NMP formation and then treated with RA for 10 days (control). In the experimental samples, BMPs were added at day 1 (BMP4+1), day 2 (BMP4+2) or day 4 (BMP4+4) after EB formation, until day 10. Samples were further differentiated for 6 days and then processed for immunohistochemistry (IHC). (C) EBs were labeled with antibodies against LHX2 (dI1, green), <t>FOXD3</t> (dI2, white), ISL1 (dI3, red) and DAPI (all nuclei, blue). (D, E) Quantification of EBs formed from either d4 (D) or d10 (E) NMPs, suggests that dI1s form robustly from the BMP4+1 condition for both d4 and d10 NMPs. In contrast, dI3s form most robustly from BMP4+4 condition for d4 NMPs and the BMP4+1 condition for d10 NMPs. Probability of similarity between control and experimental groups: * p<0.05, ** p<0.005, *** p<0.0005; two-way ANOVA.
    Morpholino Foxd3 Mo Aug 5 Cactggtgcctccagacagggtcat 3 Gene Tools, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxd3/pENTR5'_ubi+(Plasmid+%2327320)/pm41072418-243-156-171
    Average 93 stars, based on 1 article reviews
    morpholino foxd3 mo aug 5 cactggtgcctccagacagggtcat 3 gene tools - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc rabbit anti phospho tau ser404
    (A, B) EBs were generated at day 0 after either d4 (A) or d10 (B) NMP formation and then treated with RA for 10 days (control). In the experimental samples, BMPs were added at day 1 (BMP4+1), day 2 (BMP4+2) or day 4 (BMP4+4) after EB formation, until day 10. Samples were further differentiated for 6 days and then processed for immunohistochemistry (IHC). (C) EBs were labeled with antibodies against LHX2 (dI1, green), <t>FOXD3</t> (dI2, white), ISL1 (dI3, red) and DAPI (all nuclei, blue). (D, E) Quantification of EBs formed from either d4 (D) or d10 (E) NMPs, suggests that dI1s form robustly from the BMP4+1 condition for both d4 and d10 NMPs. In contrast, dI3s form most robustly from BMP4+4 condition for d4 NMPs and the BMP4+1 condition for d10 NMPs. Probability of similarity between control and experimental groups: * p<0.05, ** p<0.005, *** p<0.0005; two-way ANOVA.
    Rabbit Anti Phospho Tau Ser404, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxd3/FoxD3+Rabbit+mAb/10__4103_slash_nrr__nrr___d___25___00006-153-19-25
    Average 96 stars, based on 1 article reviews
    rabbit anti phospho tau ser404 - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    93
    Addgene inc for1
    (A, B) EBs were generated at day 0 after either d4 (A) or d10 (B) NMP formation and then treated with RA for 10 days (control). In the experimental samples, BMPs were added at day 1 (BMP4+1), day 2 (BMP4+2) or day 4 (BMP4+4) after EB formation, until day 10. Samples were further differentiated for 6 days and then processed for immunohistochemistry (IHC). (C) EBs were labeled with antibodies against LHX2 (dI1, green), <t>FOXD3</t> (dI2, white), ISL1 (dI3, red) and DAPI (all nuclei, blue). (D, E) Quantification of EBs formed from either d4 (D) or d10 (E) NMPs, suggests that dI1s form robustly from the BMP4+1 condition for both d4 and d10 NMPs. In contrast, dI3s form most robustly from BMP4+4 condition for d4 NMPs and the BMP4+1 condition for d10 NMPs. Probability of similarity between control and experimental groups: * p<0.05, ** p<0.005, *** p<0.0005; two-way ANOVA.
    For1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxd3/pWPXL-FoxD3+(Plasmid+%2336982)/pm40888762-303-4-31
    Average 93 stars, based on 1 article reviews
    for1 - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology antibodies against foxd3
    (A, B) EBs were generated at day 0 after either d4 (A) or d10 (B) NMP formation and then treated with RA for 10 days (control). In the experimental samples, BMPs were added at day 1 (BMP4+1), day 2 (BMP4+2) or day 4 (BMP4+4) after EB formation, until day 10. Samples were further differentiated for 6 days and then processed for immunohistochemistry (IHC). (C) EBs were labeled with antibodies against LHX2 (dI1, green), <t>FOXD3</t> (dI2, white), ISL1 (dI3, red) and DAPI (all nuclei, blue). (D, E) Quantification of EBs formed from either d4 (D) or d10 (E) NMPs, suggests that dI1s form robustly from the BMP4+1 condition for both d4 and d10 NMPs. In contrast, dI3s form most robustly from BMP4+4 condition for d4 NMPs and the BMP4+1 condition for d10 NMPs. Probability of similarity between control and experimental groups: * p<0.05, ** p<0.005, *** p<0.0005; two-way ANOVA.
    Antibodies Against Foxd3, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/foxd3/FOXD3+Antibody/pmc10861880__pnas__2312861121__sapp-87-10-13
    Average 93 stars, based on 1 article reviews
    antibodies against foxd3 - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    Image Search Results


    (A) Single nuclei were isolated from cortices after dMCAO on days 3 ( n = 3), 7 ( n = 4), 14 ( n = 3), and 28 ( n = 4) and compared with sham controls ( n = 3). (B)–(H) derive from these datasets. (B) Unsupervised clustering of 107,020 nuclei identified 14 clusters. PC, progenitor cell. (C) Early NC signature scoring (Wnt1-associated) highlighted a high-scoring subpopulation within C11. (D) NC regulatory genes (Tfap2b, Foxd1, Sned1, and Eya2) were enriched in C11. (E) DEG analysis of C11 visualized by UMAP and force-directed layout/embedding (FLE) identified NC-related subsets. (F) GO analysis revealed SC2, SC3, and SC5 subclusters as enriched for NCC migration, development, and differentiation. (G) Subclusters refined into seven subsets: SC2 (subsets 1, 2, 4, and 6), SC3 (subsets 0 and 3), and SC5 (subset 5). (H) Upregulated genes in each cluster were consistent with NC lineage programs. (I) GSEA showed subset 1 enriched for stromal signatures and subsets 0 and 3 enriched for radial glia-like signatures. (J) Venn diagram comparing pericyte cluster C13 and subsets 2, 4, and 6. (K–P) Immunohistochemical validation of cluster- and subset-specific markers (low-power anatomical context in ). (K) Klf5 + (subsets 1 and 5) and Bmp7 + (subsets 0 and 3) cells co-localized with Foxd3. (L) CD271 + cells were present in layers I–IV ipsilateral to dMCAO; a subset co-expressed Bmp7. (M) Klf5 + cells co-localized with CD271 in cortical layer II/III. (N) Subset 4: PDGFRβ + /Col3a1 + cells; subset 6: Col3a1 + /PDGFRβ − cells. (O) Subset 2: Ebf2 + /Cped1 + cells adjacent to CD31 + vessels. (P) No co-expression of PDGFRβ and Cped1 (specificity control). DAPI labels nuclei. (Q) Integration of snRNA-seq with spatial transcriptomics showed subsets 2 and 5 enriched ipsilaterally on day 3 post dMCAO and SC3 subsets localized to leptomeninges on days 3 and 14. (R) Representative genes of refined SC2/SC3/SC5 plotted on UMAP. (S–U) CD271 + meningeal cells isolated 3 days post tMCAO (S), expanded in vitro (T), and confirmed to express CD271 and Foxd3 (U). (V) C11 subdivided into SC2, SC3, and SC5, each further resolved into seven subsets based on upregulated DEGs, with NC-lineage enrichment. PC, pericyte; SMC, smooth muscle cell; MG, microglia; FB, vascular fibroblast-like cell; OL, oligodendrocyte; EC, endothelial cell; AC, astrocyte; v, venous; capil, capillary; a, arterial; aa, arteriolar; 1/2/3, subtypes.

    Journal: Cell reports

    Article Title: Adult leptomeningeal vestigial neural crest-derived multipotent cells promote vascular repair after stroke

    doi: 10.1016/j.celrep.2025.116747

    Figure Lengend Snippet: (A) Single nuclei were isolated from cortices after dMCAO on days 3 ( n = 3), 7 ( n = 4), 14 ( n = 3), and 28 ( n = 4) and compared with sham controls ( n = 3). (B)–(H) derive from these datasets. (B) Unsupervised clustering of 107,020 nuclei identified 14 clusters. PC, progenitor cell. (C) Early NC signature scoring (Wnt1-associated) highlighted a high-scoring subpopulation within C11. (D) NC regulatory genes (Tfap2b, Foxd1, Sned1, and Eya2) were enriched in C11. (E) DEG analysis of C11 visualized by UMAP and force-directed layout/embedding (FLE) identified NC-related subsets. (F) GO analysis revealed SC2, SC3, and SC5 subclusters as enriched for NCC migration, development, and differentiation. (G) Subclusters refined into seven subsets: SC2 (subsets 1, 2, 4, and 6), SC3 (subsets 0 and 3), and SC5 (subset 5). (H) Upregulated genes in each cluster were consistent with NC lineage programs. (I) GSEA showed subset 1 enriched for stromal signatures and subsets 0 and 3 enriched for radial glia-like signatures. (J) Venn diagram comparing pericyte cluster C13 and subsets 2, 4, and 6. (K–P) Immunohistochemical validation of cluster- and subset-specific markers (low-power anatomical context in ). (K) Klf5 + (subsets 1 and 5) and Bmp7 + (subsets 0 and 3) cells co-localized with Foxd3. (L) CD271 + cells were present in layers I–IV ipsilateral to dMCAO; a subset co-expressed Bmp7. (M) Klf5 + cells co-localized with CD271 in cortical layer II/III. (N) Subset 4: PDGFRβ + /Col3a1 + cells; subset 6: Col3a1 + /PDGFRβ − cells. (O) Subset 2: Ebf2 + /Cped1 + cells adjacent to CD31 + vessels. (P) No co-expression of PDGFRβ and Cped1 (specificity control). DAPI labels nuclei. (Q) Integration of snRNA-seq with spatial transcriptomics showed subsets 2 and 5 enriched ipsilaterally on day 3 post dMCAO and SC3 subsets localized to leptomeninges on days 3 and 14. (R) Representative genes of refined SC2/SC3/SC5 plotted on UMAP. (S–U) CD271 + meningeal cells isolated 3 days post tMCAO (S), expanded in vitro (T), and confirmed to express CD271 and Foxd3 (U). (V) C11 subdivided into SC2, SC3, and SC5, each further resolved into seven subsets based on upregulated DEGs, with NC-lineage enrichment. PC, pericyte; SMC, smooth muscle cell; MG, microglia; FB, vascular fibroblast-like cell; OL, oligodendrocyte; EC, endothelial cell; AC, astrocyte; v, venous; capil, capillary; a, arterial; aa, arteriolar; 1/2/3, subtypes.

    Article Snippet: Relative levels of genes were determined by amplifying FOXD3 (Applied Biosystems, Mm02384867_s1), TFAP2 (Applied Biosystems, Mm00493468_m1), SOX10 (Applied Biosystems, Mm00569909_m1), NGFR (Applied Biosystems, Mm00446296_m1), PRRX2 (Applied Biosystems, Mm00436428_m1), TWIST1 (Applied Biosystems, Mm00442036_m1) and normalized by housekeeping gene HPRT (Applied Biosystems, Mm01545399_m1).

    Techniques: Isolation, Migration, Immunohistochemical staining, Biomarker Discovery, Expressing, Control, In Vitro

    (A) In adult C57BL/6J mice, CD271 + cells (subset 5) were detected in the meninges, cranial sutures, and skull marrow but absent from the cortex. DAPI labels nuclei. (B and C) CD271 + cells isolated from leptomeninges-enriched tissue showed high expression of Tfap2 , Foxd3 , and Sox10 compared with cortical cells ( n = 3). All data are mean ± SD. (D and E) Human leptomeninges also contained CD271 + cells. After MACS isolation (D) and short-term expansion, these cells expressed HNK-1, Sox10, and CXCR4 (E). (F) CD271 + meningeal cells increased ipsilaterally after tMCAO or dMCAO and migrated into the injured cortex only on the infarcted side. (G) On day 3 after tMCAO, CD271 + cells upregulated Ngfr , Tfap2 , Foxd3 , Prrx2 , and Twist1 , while Sox10 was downregulated ( n = 4). All data are mean ± SD. (H–M) Endogenous meningeal NCC labeling and fate tracking. (H) AAV-CAG-tdTomato was applied to the leptomeninges; two-photon imaging was performed before and 3 days post tMCAO. (I) Flow cytometry confirmed that tdTomato + cells co-expressed CD271. (J and K) tdTomato + cells migrated from meninges into the ipsilateral cortex and localized near CD31 + vessels. (L) tdTomato + cells co-expressed CD271 on day 3. (M) A subset expressed NeuN by day 10, consistent with alternative NC-derived neuronal fates. (N–R) Transplantation of exogenous CD271 + NCCs to confirm meningeal-to-cortex migration. (N) CD271 + cells were isolated from injured cortex 3 days post tMCAO. (O) These cells formed vimentin + /Foxd3 + spheres. (P) Under defined conditions, they differentiated into NeuroTrace + neurons (NGF + brain-derived neurotrophic factor [BDNF]) or SMA + smooth muscle (TGF-β + fetal bovine serum [FBS]). (Q) PKH26-labeled CD271 + cells were transplanted onto the meninges of a second mouse on day 1 post tMCAO. (R) By day 3, PKH26 + cells localized adjacent to CD31 + vessels in cortical layers II/III and IV. All data are mean ± SD.

    Journal: Cell reports

    Article Title: Adult leptomeningeal vestigial neural crest-derived multipotent cells promote vascular repair after stroke

    doi: 10.1016/j.celrep.2025.116747

    Figure Lengend Snippet: (A) In adult C57BL/6J mice, CD271 + cells (subset 5) were detected in the meninges, cranial sutures, and skull marrow but absent from the cortex. DAPI labels nuclei. (B and C) CD271 + cells isolated from leptomeninges-enriched tissue showed high expression of Tfap2 , Foxd3 , and Sox10 compared with cortical cells ( n = 3). All data are mean ± SD. (D and E) Human leptomeninges also contained CD271 + cells. After MACS isolation (D) and short-term expansion, these cells expressed HNK-1, Sox10, and CXCR4 (E). (F) CD271 + meningeal cells increased ipsilaterally after tMCAO or dMCAO and migrated into the injured cortex only on the infarcted side. (G) On day 3 after tMCAO, CD271 + cells upregulated Ngfr , Tfap2 , Foxd3 , Prrx2 , and Twist1 , while Sox10 was downregulated ( n = 4). All data are mean ± SD. (H–M) Endogenous meningeal NCC labeling and fate tracking. (H) AAV-CAG-tdTomato was applied to the leptomeninges; two-photon imaging was performed before and 3 days post tMCAO. (I) Flow cytometry confirmed that tdTomato + cells co-expressed CD271. (J and K) tdTomato + cells migrated from meninges into the ipsilateral cortex and localized near CD31 + vessels. (L) tdTomato + cells co-expressed CD271 on day 3. (M) A subset expressed NeuN by day 10, consistent with alternative NC-derived neuronal fates. (N–R) Transplantation of exogenous CD271 + NCCs to confirm meningeal-to-cortex migration. (N) CD271 + cells were isolated from injured cortex 3 days post tMCAO. (O) These cells formed vimentin + /Foxd3 + spheres. (P) Under defined conditions, they differentiated into NeuroTrace + neurons (NGF + brain-derived neurotrophic factor [BDNF]) or SMA + smooth muscle (TGF-β + fetal bovine serum [FBS]). (Q) PKH26-labeled CD271 + cells were transplanted onto the meninges of a second mouse on day 1 post tMCAO. (R) By day 3, PKH26 + cells localized adjacent to CD31 + vessels in cortical layers II/III and IV. All data are mean ± SD.

    Article Snippet: Relative levels of genes were determined by amplifying FOXD3 (Applied Biosystems, Mm02384867_s1), TFAP2 (Applied Biosystems, Mm00493468_m1), SOX10 (Applied Biosystems, Mm00569909_m1), NGFR (Applied Biosystems, Mm00446296_m1), PRRX2 (Applied Biosystems, Mm00436428_m1), TWIST1 (Applied Biosystems, Mm00442036_m1) and normalized by housekeeping gene HPRT (Applied Biosystems, Mm01545399_m1).

    Techniques: Isolation, Expressing, Labeling, Imaging, Flow Cytometry, Derivative Assay, Transplantation Assay, Migration

    (A, B) EBs were generated at day 0 after either d4 (A) or d10 (B) NMP formation and then treated with RA for 10 days (control). In the experimental samples, BMPs were added at day 1 (BMP4+1), day 2 (BMP4+2) or day 4 (BMP4+4) after EB formation, until day 10. Samples were further differentiated for 6 days and then processed for immunohistochemistry (IHC). (C) EBs were labeled with antibodies against LHX2 (dI1, green), FOXD3 (dI2, white), ISL1 (dI3, red) and DAPI (all nuclei, blue). (D, E) Quantification of EBs formed from either d4 (D) or d10 (E) NMPs, suggests that dI1s form robustly from the BMP4+1 condition for both d4 and d10 NMPs. In contrast, dI3s form most robustly from BMP4+4 condition for d4 NMPs and the BMP4+1 condition for d10 NMPs. Probability of similarity between control and experimental groups: * p<0.05, ** p<0.005, *** p<0.0005; two-way ANOVA.

    Journal: bioRxiv

    Article Title: In vivo human embryonic spinal cord atlas validates stem cell–derived human dorsal interneurons and reveals ASD spinal signatures

    doi: 10.64898/2025.12.22.696129

    Figure Lengend Snippet: (A, B) EBs were generated at day 0 after either d4 (A) or d10 (B) NMP formation and then treated with RA for 10 days (control). In the experimental samples, BMPs were added at day 1 (BMP4+1), day 2 (BMP4+2) or day 4 (BMP4+4) after EB formation, until day 10. Samples were further differentiated for 6 days and then processed for immunohistochemistry (IHC). (C) EBs were labeled with antibodies against LHX2 (dI1, green), FOXD3 (dI2, white), ISL1 (dI3, red) and DAPI (all nuclei, blue). (D, E) Quantification of EBs formed from either d4 (D) or d10 (E) NMPs, suggests that dI1s form robustly from the BMP4+1 condition for both d4 and d10 NMPs. In contrast, dI3s form most robustly from BMP4+4 condition for d4 NMPs and the BMP4+1 condition for d10 NMPs. Probability of similarity between control and experimental groups: * p<0.05, ** p<0.005, *** p<0.0005; two-way ANOVA.

    Article Snippet: The following antibodies were used: LHX2 (mouse; DSHB, PCRP-LHX2-1C11; 1:50), FOXD3 (guinea pig, a gift from Thomas Mueller, Germany, 1:10,000), ISL1 (goat; R&D systems, AF1837; 1:500), PAX2 (rabbit; Invitrogen, 71-6000; 1:500), LMX1B (guinea pig; Thomas Muller Lab), LHX1/5 (mouse; DSHB, 4F2; 1:50) for 12–14 hours (overnight) at 2–8°C in a humidified chamber.

    Techniques: Generated, Control, Immunohistochemistry, Labeling